<<

стр. 2
(всего 2)

СОДЕРЖАНИЕ

женных I. belli. Непрерывное выделение с фекалиями больного ог-
воротки крови выявило при эритемной форме заболевания в остром
ромного числа ооцист этого патогена в течение многих недель наво-
периоде повышение ИФ-? до 39,5±9,9 МЕ/мл, при низком уровне
дит на мысль о непрерывной продукции заразного начала, объем
ИФ-?- 7,3±1,8 МЕ/мл (К ?/?-5,4) (табл.2). При безэритемной форме
которой значительно превышает уровень максимального теоретиче-
ИКБ, отмечалась выраженная блокада образования ?- ИФ по срав-
ски мыслимого исходного инокулума. Это, в свою очередь, позволя-
нению с эритемной формой заболевания (р<0,001). Продукция ?-
ет предположить наличие в жизненном цикле I. belli не только ки-
ИФ при обеих формах боррелиоза не различалась, что приводило к
шечной, но и внекишечной фазы развития. Это предположение ос-
изменению коэффициента отношения ИФ-?/ ИФ-? при двух формах
новывается на данных о наличии такой фазы у других видов
заболевания в 2,2 раза.
Isospora, таких как I. felis и I. rivolta. Правда, у этих видов кишечная
Таблица 2. Уровень ИФ-? и ИФ-? в сыворотке крови при эритем- и внекишечная фазы развития совершганы, в том числе в лимфоуз-
ной и безэритемной формах ИКБ. лы, с образованием гипнозоитов, обеспечивающих неопределенно
Уровень показателей интерферона (МЕ/мл) долгое персистирование патогена (Markus, Med. Hypoths., 1991, 35:
Период
278). В контексте настоящей дискуссии представляют также интерес
болезни ?- ИФ ?- ИФ Р
единичные случаи рассеянного изоспороза у больных со СПИДом,
эритемная форма (n-117)
когда бесполые стадии развития I. belli обнаруживались в мезенте-
острый 5,4
39,5±9,9 7,3±1,8
риальных и трахеобронхиальных лимфоузлах (Sun, Amer. J. Clin.
реконвалес-
<0,01
0,37
6,2±0,8 16,7±2,8 Pathol. 1994. 102: 16-29).
ценция
Циклоспороз как ОП протозойной природы стал известен лишь
безэритемная форма
с середины 80-х годов ХХ века, но особенно после исследований в
<0,001
острый 2,4
8,0±3,7 4,5±0,7
Перу и США (Ortega et al., New England J. Med. 1993. 328: 1308-
реконвалес-
>0,05
0,0 --- 1312). Cyclospora cayetanensis относится к числу малоизученных
18,9±3,9
ценция
эймериидных кокцидий, ооцисты которых включают две спороци-
Исследование динамики интерфероновой реакции лейкоцитов
сты, каждая с двумя спорозоитами. Подобно I. belli и C. parvum,
у больных ИКБ in vitro при воздействии различных индукторов вы-
циклоспора также вызывает длительную диарею у пациентов не
явило различие продукции ИФ, значительно отличающуюся на
только с нарушенным, но и нормальным иммунным статусом. Бо-
классические интерфероногены (вирус болезни Ньюкастла, стафи-
лезнь сопровождается тошнотой, рвотой, анорексией, потерей веса
лококковый энтеротоксин А) по сравнению с воздействием борре-
25
56
www.tick.ru
Для больных безэритемной формой в отличие от эритемной ха-
и, главное, водянистой диареей продолжительностью от 1-3 нед. до
рактерным было острое начало с повышение температуры, которая
50 сут. Число наблюдений за пациентами со СПИДом пока еще не-
достаточно, хотя есть сообщения и о летальных исходах. почти у половины больных была выше 38,5°С. Кроме регионально-
Отнесение циклоспороза к категории ОИ представляется весьма го лимфаденита у 41,6% детей наблюдалось одновременное увели-
неожиданным, поскольку до недавнего времени кокцидии рода чение всех групп лимфатических узлов (полиаденит) и 1/4 случаев
Cyclospora были известны только у таких несхожих между собой –увеличение печени. Достоверно чаще отмечались симптомы ин-
хозяев, как рептилии, насекомоядные, мышевидные грызуны и даже токсикации в виде снижения аппетита.
беспозвоночные (многоножки). Но виды Cyclospora из этих хозяев Анализ течения ИКБ при двух формах инфекции показал, что
четко отличаются от человеческого вида, С. cayetanensis. К сожале- среди 117 больных у 37 детей (31,6%) в среднем на 7,4±1,6 сутки (до
нию, полный жизненный цикл этого патогена еще не изучен. 18 суток от начала заболевания) выявлялись различные синдромы
Криптоспоридиоз в последние десятилетия занял прочное место поражения нервной системы и внутренних органов достоверно чаще
среди признанных ОП протозойной природы. Возбудителями этой при безэритемной по сравнению с эритемной формой (53,4% против
инфекции являются кокцидии рода Cryptosporidium. Кроме кишеч- 29,1%). Среди синдромов преобладали проявления нейроборрелиоза
ника, криптоспоридии поражают также и другие органы хозяина, у 28 детей (75,7%), реже кардиопатии – у 15 (40,5%) и рецидиви-
однако их развитие приурочено к эпителиальным клеткам, имею- рующие эритемы - у 9 (24,3 %) детей, артриты- у 3 (8,1%) и гепатит
щим на апикальном конце щеточную каемку из микроворсинок. – у 1 больного (2,7%). В отличие от взрослых, для детей характер-
Симптомы заболевания при криптоспоридиозе напоминают таковые ным было более раннее уже на 2-й недели болезни развитие пора-
при изоспорозе и циклоспорозе - длительная профузная диарея, жения различных органов [5, 6]. Диспансерное наблюдение детей и
приводящая к значительному обезвоживанию организма; при СПИ- лабораторный мониторинг в течение 3-5 лет показали, что хрониче-
Де описаны редкие летальные случаи. ское течение инфекции, выявленное у 33 детей, также преобладало
Всестороннее экспериментальное исследование жизненного при безэритемной форме по сравнению с эритемной (37,2% против
цикла C. parvum, в том числе проведенное в Лаборатории цитологии 17,7%). Особенностью клинических проявлений хронического тече-
одноклеточных организмов Института цитологии РАН (Бейер, 1989, ния было вовлечение нервной системы у подавляющего числа боль-
Клеточная биология споровиков - возбудителей протозойных болез- ных- 81,8%. Синдромы поражения других органов чаще сочетались
ней животных и человека; Свежова, Паразитология, 1997, 31: 328- с нейроборрелиозом, а изолированные (лимфоцитома, артриты) со-
333), позволило выявить у этого кишечного патогена феномен пер- ставили 4,5%.
систирования особого рода. В отличие от подавляющего большин- Анализ клинических проявлений ИКБ в возрастном аспекте по-
ства других кишечных кокцидий, ооцисты криптоспоридий спору- зволил установить, что у детей младшего возраста от 3мес. до 6лет
лируют еще до их выделения с feces хозяина, т.е. приобретают инва- (43 ребенка) частота рецидивирующих эритем, лихорадки выше
зионность in situ, в организме хозяина. Часть ооцист выделяется во 38,0°С, полиаденита, увеличения печени достоверно чаще встреча-
внешнюю среду, а другая часть остается в хозяине. Оказалось, что лась по сравнению с группой больных от 7 до 14 лет (р< 0,01). Дети
большую роль в сохранении таких ооцист играют клетки иммунной школьного возраста, особенно подростковой группы, оказались в
системы, в первую очередь макрофаги. Электронномикроскопиче- группе риска по развитию хронического течения ИКБ (43% против
ские исследования подтвердили достаточно длительную сохран- 15%), что, по-видимому, связано с неустойчивыми механизмами
ность ооцист C. parvum, находящихся внутри макрофагов, фагоци- адаптационных функций, вегетативной и эндокринной перестрой-
тировавших такие ооцисты. кой в этом возрасте.
Спорулированные ооцисты C. parvum содержат по четыре спо- Изучение образования и элиминации АТ и иммунных комплек-
розоита, окруженных единственной спороцистой. В условиях имму- сов (ИК) при ИКБ позволило установить, что при эритемной форме
нодефицита хозяина может происходить спонтанное разрушение в остром периоде наблюдается нарастание АТ с высокой активно-
клеток иммунной системы, включая макрофаги, и вышедшие из них стью у 62,5% больных и появление ОИК в 29,1% случаев, что в
ооцисты могут легко эксцистироваться под действием жидкостей сочетании с последующим увеличением СИК в периоде реконва-
55
26
www.tick.ru
самого организма (особенность ооцист криптоспоридий). Высвобо-
последующие дни медленнее, достигая диаметра до 10,0-28,0см (в
дившиеся спорозоиты, будучи стадиями с бесполыми потенциями,
среднем 11,5± 1,6 см). При присасывании клеща в область волоси-
будут внедряться в клетки кишечного эпителия и инициировать но-
стой части головы эритема имела форму полосы шириной 1,0-2,0см.
вые раунды мерогонии (бесполого размножения), которые в услови-
Почти во всех случаях МЭ сопровождалась отеком и инфильтраци-
ях иммунодефицита хозяина могут оказаться неконтролируемыми
ей мягких тканей, зудом и болезненностью. Одновременно с разви-
по своим масштабам. Это станет возможным благодаря еще одной
тием МЭ или на 2-3сутки болезни в 87,1% случаев наблюдался
биологической особенности криптоспоридий - способности меро-
подъем температуры, который в половине случаев не превышал
зоитов 1-й генерации к рециклированию. Сходный механизм умно-
37,5°С. У большинства детей развитие МЭ сопровождалось появле-
жения числа мерозоитов той же генерации достоверно известен и у
нием регионального лимфаденита.
T. gondii при развитии в кишечнике фелидного хозяина.
Таблица 1. Частота клинических симптомов при эритемной и
Приведенные данные показывают, что длительное сохранение
безэритемной формах ИКБ у детей.
криптоспоридий в организме хозяина с нормальной иммунной сис-
эритемная форма безэритемная форма темой возможно благодаря способности этого патогена перистиро-
Клинические сим-
n-93 n-24 вать в клетках иных, чем кишечные. При этом паразит получает
птомы
n % n % пристанище в макрофагах и других клетках иммунной системы, ко-
Диаметр эритемы: 93 100% --- --- торые вопреки их изначальной функции фагоцитирования и унич-
От 3 до 27 29,0% --- --- тожения чужеродных элементов, попадающих в организм, с готов-
9см ностью выполняют роль клетки хозяина для опасного патогена.
Персистирование ооцист (спорозоитов) C. parvum в таких клетках
От 10 до 49 52,7% --- ---
не препятствует их дальнейшему реактивированию в условиях им-
15см
мунодефицита хозяина.
От 16 12 12,9% --- ---
Итак, при изучении внутриклеточных паразитов (кокцидий) нам
до20см
удалось провести определенный водораздел между оппортунисти-
Более 5 5,4% --- ---
ческими и не-оппортунистическими патогенами на основе различий
21см
в соотношении процессов пролиферации и дифференцировки в их
Температура, ° С 81 87,1% 19 79,1%
жизненных циклах. Если стадии, способные персистирвать, имеют
37,0-37,5 39 3
48,1%? 15,8%?
потенции бесполых клеток, то при снятии иммунного надзора они
37,6-38,4 22 27,2% 7 36,8%
смогут приступить к бесконтрольному размножению в хозяине, что
выше 38,5 20 9
24,7%? 47,3%? вызовет впоследствии инфекционный процесс. Если же латентными
Региональный 66 70,9% 11 45,8% оказываются дифференцированные клетки, то даже при СПИДе они
лимфаденит окажутся неспособными к размножению в силу своих биологиче-
Полиаденит 19 10
20,4%? 41,6%? ских особенностей.
Вялость 17 18,3% 9 37,5% В данном сообщении речь шла о четырех видах эймериидных
Снижение аппе- 17 10
18,3%? 45,8%? кокцидий, квалифицируемых в современной литературе как возбу-
тита дители ОИ. Не исключено, что в ходе дальнейших исследований
Увеличение пече- 14 15,1% 6 25,0% число ОП среди кокцидий и в целом среди споровиков может уве-
ни личиться. В частности, в терминах нашей рабочей гипотезы пред-
ставляет интерес рассмотрение такого глобального паразитологиче-
Конъюнктивит 5 5,4% 1 4,2%
ского заболевания как малярия. В экзоэритроцитарной (печеночной)
Боль в животе 2 2,2% 3 12,5%
фазе жизненных циклов двух видов Plasmodium человека (P. vivax,
?-достоверные различия
P. ovale) и нескольких видов Plasmodium обезьян были выявлены
27
54
www.tick.ru
лет –90 детей (76,9%). До 2-х лет ИКБ наблюдался только в 7 слу-
стадии, гомологичные гипнозоитам эймериидных кокцидий
чаях (6,0%), из них самому младшему ребенку было 3 месяца. Дети
(Krotoski et al., Amer. J. Trop. Med. Hyg., 1982, 31: 1291-1293). Обра-
от 11 до 14 лет составили 17,1%. Больным проводился клинико-
зование таких персистирующих стадий обусловлено биологически-
неврологический и лабораторный мониторинг в остром периоде и
ми особенностями данных возбудителей, в частности, наличием
при диспансерном наблюдении в течение 3-5 лет. При выявлении
значительного сезонного перерыва в передаче паразита от одного
симптомов прогрессирования заболевания дети повторно госпита-
хозяина к другому в рамках облигатно-гетероксенного жизненного
лизировались в клинику НИИДИ. Лабораторная диагностика при
цикла плазмодиев.
исследовании парных сывороток крови включала как метод н-РИФ
Теоретически малярию можно рассматривать как ОИ, хотя и с
с коммерческим корпускулярным антигеном боррелии производст-
некоторыми оговорками. Так, до сих пор остается невыясненным
ва НИИЭМ им. Н.Ф.Гамалеи, с содержанием в 1мл 106 микробных
вопрос о механизмах стимуляции (реактивации) гипнозоитов P.
тел, так и комплементарно -ферментный тест (КФ-тест), основан-
vivax/ovale. Кроме того, отсутствует достоверная информация о
ный на реакции связывания комплемента и позволяющий опреде-
влиянии иммунодефицитного состояния пациента на проявление у
лить уровень активности специфических антител (АТ), общих им-
него симптомов заболевания малярией, вызванной указанными воз-
мунных комплексов (ОИК) и специфических иммунных комплексов
будителями. В то же время имеются данные о том, что у ВИЧ-
(СИК). Показатели АТ, СИК и ОИК определялись в относительных
инфицированных не наблюдается ухудшения состояния здоровья на
единицах (ОЕ). Для исключения клещевого энцефалита (КЭ) и
фоне тропической малярии и что само по себе заражение тропиче-
микст – форм (ИКБ+ КЭ) применялись методы РТГА и ИФА с ком-
ской малярией также не ускоряет течения ВИЧ-инфекции (Nguyen-
мерческим диагностикумом для иммуноферментной тест-системы
Dinh et al., Bull WHO, 1987, 65: 607-613). Однако эти оптимистиче-
ЗАО “Вектор-Бест”. Исследование интерфероногенеза проводи-
ские наблюдения нисколько не приближают нас к решению постав-
лось с разделением на ? и ? - интерфероны (ИФ) при исследовании
ленного вопроса – можно ли малярию относить к категории ОИ, по-
скольку возбудитель тропической малярии, P. falciparum, в силу крови больных, а также в интерфероновой реакции лейкоцитов
своих биологических особенностей, не имеет гипнозоитов в своем (ИРЛ) крови in vitro в ответ на индукторы ИФ- вирус болезни Нью-
жизненном цикле. кастла, стафилококковый энтеротоксин А и антиген боррелий.
Итак, на сегодняшний день проблема ОИ и ОП еще далека от Результаты исследования и обсуждение. Анализ клиники
своего решения, хотя ее важность не вызывает сомнения. По мне- ИКБ у 117 детей выявил различную частоту симптомов, особенно-
нию А.Я. Лысенко (Мед. паразитол. и паразит. бол., 1994, 4: 3-8), сти течения и исходов в зависимости от наличия основного диагно-
эта проблема заслуживает включения в приоритетную федеральную стического признака - мигрирующей эритемы (МЭ), которая воз-
научно-практическую программу, к реализации которой должны никла у подавляющего числа заболевших – 93чел. (79,5%) в случаях
быть привлечены специалисты разных профилей - паразитологи, эритемной формы инфекции, либо её отсутствия при безэритемной
цитологи, иммунологи, инфекционисты, патологи. На фоне все бо- форме заболевания -24чел. (20,5%) (табл.1).Инкубационный период
лее устрашающих сведений о размахе наркомании и ВИЧ- при ИКБ составил в среднем 8,5±0,9 дней, с колебаниями от 1 до 25
инфицированности в нашей стране эти слова должны восприни- дней, Однако был достоверно короче в группе детей с безэритемной
маться не только как мудрое пожелание, но и как призыв к дейст- формой по сравнению с эритемной (р< 0,02). Больные поступали в
вию. стационар на 1-3 сутки от начала заболевания, в отдельных случаях
- на 7-20 сутки.
Работа выполнена при поддержке фонда РФФИ 01-04- При эритемной форме манифестация инфекции происходила с
49322. развития МЭ в месте присасывания клеща. МЭ чаще была в виде
кольца (76,4%), реже имела сплошную окраску (23,6%). Нередко
МЭ имела 2 и более колец, а в 24,6% случаев, в центре её появля-
лись везикулы или буллы от 0,1до 1,5см в диаметре или петехиаль-
ная сыпь. В первые сутки МЭ быстро увеличивалась в размере, в
53
28
www.tick.ru
ДИАГНОСТИКА ПРИОБРЕТЕННОГО ТОКСОПЛАЗМОЗА
КЛИНИКО-ИММУНОЛОГИЧЕСКИЕ ОСОБЕННОСТИ ЭРИ-
ТЕМНОЙ И БЕЗЭРИТЕМНОЙ ФОРМ ИКСОДОВОГО КЛЕ-
Васильев В.В.
ЩЕВОГО БОРРЕЛИОЗА У ДЕТЕЙ
Кафедра инфекционных болезней Российской ВМедА, Центр диаг-
М.Н. Сорокина, О.А. Аксёнов, Н.В. Скрипченко, Г.П. Иванова, Е.А. ностики и лечения токсоплазмоза
Мурина, Ю.В. Васильева

НИИ детских инфекций МЗ России, г. Санкт-Петербург
Т оксоплазмоз как одна из причин инфекционной патологии
человека впервые привлек внимание в 1923 г., когда чеш-
ский офтальмолог I. Yanku описал клинические проявления тяжело-
И нтерес к проблеме иксодового клещевого боррелиоза воз- го врожденного заболевания у погибшего ребенка и выделил возбу-
ник в 80-е годы после открытия возбудителя заболевания дителя из сетчатки. Через 15 лет американские исследователи (A.
B. burgdorferi. Однако актуальность этой проблемы остается, что
Wolf, D. Gowen, B. Page) доказали возможность трансплацентарной
обусловлено высокой инфицированностью клещей-переносчиков,
передачи инфекции и в 1939 г. смогли прижизненно выделить ток-
составляющей от 20 до 80% и широким распространением их на
соплазмы от больного. Можно считать, что широкомасштабные ис-
территории России, а также ростом показателей заболеваемости, следования токсоплазмоза у человека начались в 40-е годы XX века,
достигающих в отдельных регионах, например в Северо-Западном когда Warren и Sabin (1942) предложили использовать реакцию
11,0 на 100тыс. населения. Известно, что инфекция в раннем перио- связывания комплемента (РСК) для выявления антител к токсоплаз-
де протекает в виде двух форм эритемной и безэритемной. Эритем-
мам, а Frenkel – внутрикожную пробу с токсоплазмином (1948).
ная форма наблюдается в 70-90% случаях и характеризуется разви-
Внедрение этих методов позволило провести многочисленные ис-
тием мигрирующей кожной эритемы (МЭ), которая рассматривается следования различных аспектов проблемы токсоплазмоза.
как клинический маркер заболевания. У 4,1-30,0% пациентов эрите- Toxoplasma gondii (родовое название токсоплазмы получили от
ма может отсутствовать (безэритемная форма), что затрудняет ран- полулунной формы бесполой стадии развития (taxon – дуга, plasmon
нюю диагностику заболевания [1, 4, 5]. Инфекция отличается часто-
– форма, фр.), видовое – от названия грызунов, обитающих в Туни-
той развития хронического течения, которая по данным различных
се) является уникальным паразитом, для которого характерны убик-
авторов составляет от 5% до 33%, но причины прогрессирования витарность, поликсенность и пантропизм. Широкому распростране-
заболевания пока окончательно не решены. До настоящего времени нию возбудителя максимально способствует наличие огромного
остаются недостаточно изученными многие клинические проявле- числа промежуточных хозяев инфекции среди животных и птиц.
ний заболевания, особенно в детском возрасте, причины развития
Не выделяя токсоплазм в окружающую среду, человек не явля-
диссеминации и хронического течения, не ясны некоторые стороны
ется источником инфекции, и также относится к промежуточным
патогенеза, связанные с элиминацией и персистенцией возбудителя
хозяевам. Реальная передача инфекции от человека к человеку осу-
[6, 9, 10]. ществляется только трансплацентарно, причем, тогда, когда зараже-
Целью нашего исследования было изучить клинические прояв- ние происходит во время беременности.
ления клещевого боррелиоза, особенности течения и исходов при На сегодняшний день актуальность приобретенного токсоплаз-
эритемной и безэритемной формах инфекции у детей разного воз-
моза обусловлена рядом социально-экономических последствий
раста и рассмотреть некоторые патогенетические аспекты заболева-
данного заболевания.
ния. Токсоплазмоз является наиболее широко распространенной па-
Материалы и методы. Материалом для исследования послу- разитарной инвазией. Доля сероположительных лиц в различных
жил анализ клиники, течения и исходов заболевания у 117 больных регионах значительно варьирует, составляя в среднем около 30 %
ИКБ. Среди заболевших преобладали дети в возрасте от 3-х до 10
численности популяции. Среди населения Земли 1,5 млрд. человек
29
52
www.tick.ru
инвазировано данным возбудителем, причем в возрастной структуре
доминируют лица молодого возраста (до 40 лет). Последние данные
(1996-1999 гг.) свидетельствуют, что в СПб число инвазированных
составляет 31 %.
Достаточно высока частота манифестных, клинически значи-
мых, форм приобретенного токсоплазмоза. В США число ежегодно
впервые выявленных манифестных форм приобретенного токсо-
плазмоза оценивается в 12100 случаев (EID, Vol. 5, N.5 – 1999).
Установлено, что токсоплазмоз является частой причиной
хориоретинитов (до 30 %), результатом которых зачастую является
резкое снижение остроты зрения, вплоть до слепоты. Огромно зна-
чение приобретенного токсоплазмоза у лиц с иммунодефицитами, в
том числе – при ВИЧ-инфекции (второе место по частоте причин Рисунок 2. Сравнение нуклеотидной последовательности фраг-
летальных исходов). мента гена p66 штамма Томск-1 с известными из GenBank генами
Экономический ущерб в США оценивается в сумму около 7,7 р66 штаммов Borrelia burgdorferi s.s. – B31, HB19, Sh2-82, Borrelia
миллиардов долларов в год (MMWR, март 2000). В РФ экономиче- afzelii – ACA1, VS461, U01, Borrelia garinii Ip90. Выведенные ами-
ский ущерб неизвестен, однако вряд ли он значительно меньше. нокислотные последовательности обозначены в стандартной меж-
Указанные факты, а так же целый ряд особенностей инфекци- дународной однобуквенной номенклатуре.
онного процесса при приобретенном токсоплазмозе, обусловливают
постоянный интерес к исследованиям, посвященным развитию воз- ВЫВОДЫ:
можностей своевременной и качественной диагностики этого забо-
Начата работа по изучению видового состава возбудителей ИКБ
левания.
на территории Томской обл. В течение 2000-01 гг. получены 3 изо-
Представляемый доклад не является прямым пособием по диаг-
лята боррелий, адаптированных к искусственной среде. Один из
ностике токсоплазмоза. Его цель – охарактеризовать возможности
изолятов идентифицирован как B. garinii.
различных методов диагностики, выделить их положительные чер-
Работы в этом направлении необходимо продолжать для созда-
ты и недостатки.
ния банка местных штаммов возбудителя. Полученные штаммы мо-
Этиологическая диагностика приобретенного токсоплазмоза
гут служить основой для создания диагностических и профилакти-
осуществляется в соответствии с общими принципами, подразуме-
ческих препаратов, совершенствования методов диагностики, про-
вающими тщательную оценку клинико-лабораторного комплекса,
филактики и лечения ИКБ.
выявление возбудителя в организме человека и установление при-
чинно-следственной связи между клиническими проявлениями и
фактом наличия зараженности.
Основной клинической особенностью приобретенного
токсоплазмоза является доминирование бессимптомных, латентных,
форм как острого, так и хронического инфекционного процесса.
Наш собственный многолетний опыт, охватывающий результа-
ты обследования, лечения и проспективного наблюдения за тысяча-
ми пациентов, показывает, что для приобретенного токсоплазмоза
характерны отсутствие патогномоничных симптомов и выражен-
ный полиморфизм клинических проявлений с поражением различ-
ных органов и систем. При этом в различные периоды болезни про-
51
30
www.tick.ru
явления, определяющие клиническую картину, могут быть различ-
Всего было получено 7 изолятов. Из них 3 изолята смогли адапти-
ными.
роваться к искусственной среде.
Сравнение частоты клинических проявлений манифестной
Нами была проведена идентификация изолята, полученного в
формы острого токсоплазмоза и периода обострения хронического
1999 г. (Томск-1). Морфологически бактерии представляют собой
токсоплазмоза показывает, что наиболее стабильными признаками
спиралевидные палочки длиной 6-20 мкм и толщиной 0,15-0,2 мкм.
являются симптомы полилимфаденита (преимущественное пораже-
Бактерии имеют жгутики (по данным электронной микроскопии) и
ние шейных, подмышечных и мезентериальных лимфатических уз-
активно перемещаются в среде путем поступательно-вращательных
лов), хронической интоксикации (субфебрилитет), гепатолиеналь-
движений (рис.1). По данным морфологическим признакам мы от-
ного синдрома без нарушения функции печени, нарушений со сто-
несли изолированные бактерии к сем. Spirochaetaceae. В реакции
роны нервной системы (психоэмоциональная лабильность, наруше-
непрямой иммунофлюоресценции бактерии реагировали с сыворот-
ния операторских функций), поражения опорно-двигательного ап-
ками больных ИКБ в титрах в 2-4 раза выше, чем с контрольным
парата без объективных признаков острого воспаления.
штаммом Borrelia afzelii Ip21 (НИИЭМ им. Н.Ф. Гамалеи, г. Моск-
Вместе с тем, следует отметить, что указанные признаки могут
ва).
наблюдаться при целом ряде других, как инфекционных, так и не
инфекционных заболеваний, в том числе при туберкулезе, онколо-
гической патологии, болезнях соединительной ткани. Поэтому, в
отличие от, например, шигеллезов, этиологический диагноз приоб-
ретенного токсоплазмоза не может быть установлен только на осно-
вании анализа клинических и эпидемиологических данных.
Помимо недостаточной определенности клинической картины,
особенности иммунопатогенеза приобретенного токсоплазмоза обу-
словливают ряд трудностей в использовании лабораторных методов
исследования для подтверждения диагноза.
Исторически наиболее старые и достоверные методы выявления
токсоплазм основаны на паразитологических методах, позволяющих
выявить возбудителя при проведении прямой микроскопии либо
Рисунок 1. Изолят боррелий Томск-1. Сканирующая электронная
нативного материала, либо после «накопления» (культуральный ме-
микроскопия (ув. х5000).
тод, биопроба на грызунах). Однако существует ряд ограничений
использования этих методов, связанных в первую очередь с тем, что
Сотрудниками ИЭМ и ЛИН (г. Иркутск) было проведено гено-
при остром токсоплазмозе в отсутствие СПИДа длительность пре-
типирование изолята с помощью полимеразной цепной реакции и
бывания токсоплазм в биологических жидкостях ограничена 2-3 не-
рестрикционного анализа ПЦР-продуктов. Продукт амплификации
делями после заражения. Позднее токсоплазмы могут быть обнару-
участка гена флагеллина боррелий длиной 688 нп был обработан
жены в различных органах, однако определенное значение имеет
эндонуклеазами AvaI, Vha464, HinfI и MspI. При применении AvaI и
только обнаружение внеклеточно расположенных трофозоитов, что
Vha464 были получены фрагменты 399, 289 и 395, 293 нп соотвест-
свидетельствует об активном размножении возбудителя. Наличие в
венно. Рестриктазы HinfI и MspI исследуемый фрагмент не расщеп-
препарате цист токсоплазм отражает всего лишь инфицирование
ляли. Такая картина рестрикции характерна для B. garinii.
ими и не может считаться основанием доказательством связи с кли-
Результаты генотипирования были подтверждены в НПФ «Хе-
ническими проявлениями, так как инфицированность населения
ликс» (г. Санкт-Петербург) путем определения нуклеотидной по-
весьма высока.
следовательности гена p66 (Рис. 2).
Несколько большая информативность прямой микроскопии на-
блюдается у больных с иммунодефицитными состояниями, когда на
31
50
www.tick.ru
фоне срыва толерантности может развиваться повторная паразите- ИЗОЛЯЦИЯ И ТИПИРОВАНИЕ ВОЗБУДИТЕЛЕЙ ИКСОДО-
мия.
ВЫХ КЛЕЩЕВЫХ БОРРЕЛИОЗОВ НА ТЕРРИТОРИИ ТОМ-
В последние годы достаточно широкое распространение полу-
СКОЙ ОБЛАСТИ
чил метод ПЦР, позволяющий выявлять в исследуемом субстрате
фрагменты генома микроорганизмов. Однако, несмотря на высокую
Стронин О.В., Шутова Н.А., Петров Е.Ю., *Хаснатинов М.А.,
чувствительность и специфичность, данный метод в целом ряде
*Беликов С.И., **Куликов В.Н., **Андрейчук Ю.В.
клинических ситуаций не имеет преимуществ перед прямым выяв-
лением токсоплазм.
ФГУП «НПО Вирион», г. Томск, Институт эпидемиологии и микро-
Теоретически, если в макроорганизме пресистирует какой-то
биологии НЦМЭ ВСНЦ СО РАМН, Лимнологический институт, г.
микроорганизм, то фрагменты последнего могут периодически быть
Иркутск*, НПФ «Хеликс», г. Санкт-Петербург**
обнаружены, так как постоянно происходит гибель и элиминация из
органов отдельных его особей. Поэтому положительные результаты
ПЦР должны быть соотнесены с той клинической ситуацией, кото-

В
рая имеет место. Например, обнаружение генома токсоплазм в сли- настоящее время доказано наличие видового разнообразия
зистой оболочке цервикального канала у беременных не несет ин- возбудителей иксодовых клещевых боррелиозов (ИКБ). Из-
формации о давности заражения, которая как раз является необхо- за широчайшего ареала распространения ИКБ, во многих регионах
димой для определения показаний к проведению профилактики Российской Федерации исследования видового состава возбудителя
врожденного токсоплазмоза. Более того, хотя токсоплазмы способ- не проводились. В том числе совершенно не изучены боррелии,
ны размножаться в любых эукариотных клетках, в эпителии слизи- циркулирующие в Томской области, которая является напряженным
стых оболочек, по данным литературы, они обнаруживаются только очагом ИКБ.
при СПИДе. Целью нашей работы является определение видов боррелий
Большее значение имеет ПЦР в определении этиологии хорио- группы B. burgdorferi s.l., циркулирующих на территории Томской
ретинитов, однако методика выявления генома токсоплазм в жидко- области. Результаты исследования позволят совершенствовать ди-
сти стекловидного тела пока еще мало доступна. агностику и лечение этого природно-очагового заболевания.
В настоящее время принято считать (и наш Центр с этим согла- Материалы и методы:
сен), что ведущая роль в диагностике приобретенного токсоплазмо- Изоляцию возбудителя ИКБ проводили из переносчиков (кле-
за во всех его проявлениях принадлежит оценке результатов сероло- щей). Клещи были собраны с растительности в Томском районе
гических методов исследования. Томской обл. в мае-июне 2000 и 2001 гг. Комплекс внутренних ор-
Хотя некоторые методики, такие как реакции связывания ком- ганов клещей засевали на среду BSK-H (Sigma), содержащую смесь
племента, иммунофлюоресценции, встречного иммуноэлектрофоре- антибиотиков для подавления сопутствующей микрофлоры (от-
за, агглютинации в наши дни имеют преимущественно историче- дельная пробирка для каждого клеща).
ское значение, тем не менее, при условии соблюдения техники по- Выделенные изоляты пересевали на полную среду BSK-H. Изу-
становки, они могут служить ориентиром для определения показа- чение свойств проводили на 4-5 пассажах изолята. Идентификацию
ний к более точным исследованиям. Однако их недостаточная чув- выделенных микроорганизмов проводили морфологическими, им-
ствительность и наличие ложных результатов существенно ограни- мунологическим и молекулярно-генетическими методами.
чивают их применение. Результаты:
В настоящее время наиболее широко распространен метод им- В ходе работы в 1999г. были отловлены 30 клещей Ixodes
муноферментного анализа (ИФА) – классический и его модифика- persulcatus. Из них самок – 29, самцов – 1. В 2001г. были отловлены
ции. Его основным преимуществом является возможность опреде- 35 клещей I. persulcatus (33 шт) и Dermacentor pictus (2 шт). Из них
ления различных классов антител, в том числе количественно, в самок – 33, самцов – 2. Через 10-15 сут после посева был зафикси-
рован рост в 4 пробах, через 40 – в 1, через 60-70 сут – в 2 пробах.
49
32
www.tick.ru
различных субстратах, что имеет большое значение для определе-
22. Rijpkema S.G.T., Molkenboer M.J.C.H., Schouls L.M., Jongelan
ния давности заражения.
F. and Schellekens J.F.P. Simultaneous Detection and Genotyp-
Вместе с тем, следует отметить, что серологические методики, в
ing of Three Genomic Groups of Borrelia burgdorferi Sensu
том числе и модификации ИФА, также не могут полностью удовле-
Lato in Dutch Ixodes ricinus Ticks by Characterization of
творить потребностям клиницистов.
theAmplified Intergenic Spacer Region between 5S and 23S
При давности заражения, превышающей 12 месяцев, определе-
rRNA Genes. J. Clin. Microbiol. 1995, 33: 3091-3095.
ние Ig G в динамике не несет положительной информации, так как
23. Егоров А.М., Осипов А.П., Дзантиев В.В., Гаврилова Е.М.
уровни этих антител не коррелируют с клиническими проявления-
Теория и практика иммуноферментного анализа // М.;
ми, а Ig M исчезают из крови в 70% случаев в течение первых 3 ме-
Высш. шк., 1991.- 288 с.
сяцев после заражения. Поэтому ни «высокие», ни «низкие» кон-
24. Laemmli U.K. Cleavage of structural proteins during the assem-
центрации Ig G сами по себе не являются основанием для этиологи-
bly of the head of bacteriophage T4. Nature, 1970, 227:680-685.
ческой верификации диагноза.
25. Михайлов А.Т., Симирский В.Н. Методы иммунохимическо-
Определение авидности антител также имеет свои недостатки,
го анадиза в биологии развития. М.: Наука, 1991, 162-176.
поскольку в ходе инфекционного процесса экспрессируются раз-
26. 26.Burnette W.N. “ Western blotting”: electrophoretic transfer of
личные антигены с выработкой различных специфических антител,
proteins from sodium dodecil sulfate-polyacrilamide gels to un-
авидность которых также не одинакова.
modified nitrocellulose and radiographic detection with antibody
С практической точки зрения ценность серологических методик
and radioiodination protein A. Anal. Biochem. 1981, 12: 195-
состоит с одной стороны, в возможности быстро, относительно де-
203.
шево и весьма точно определить факт зараженности данного паци-
ента токсоплазмами, с другой стороны – при обнаружении Ig M в
количествах в 2 и более раз превышающих cut-off реакции можно
констатировать наличие острого токсоплазмоза у обследуемого.
Самые большие трудности возникают при наличии у пациента
клинических проявлений, сходных с теми, которые наблюдаются в
период обострения хронического токсоплазмоза. По нашим данным
кальцификаты в веществе головного мозга (что считается достаточ-
но убедительным признаком токсоплазмоза) обнаруживаются толь-
ко 36 % пациентов, хориоретинит – у 12 %. Вместе с тем и кальцфи-
каты, и хориоретиниты могут иметь и другую, отличную от токсо-
плазменной, этиологию (ЦМВИ, туберкулез и т.д.).
В течение ряда лет в нашем Центре разрабатывались и сейчас
успешно используются несколько схем дифференциальной диагно-
стики токсоплазмоза с учетом конкретных клинических ситуаций
(возраст, беременность или ее отсутствие, наличие иммунодефицита
и т.д.). Подробную информацию по критериям диагностики можно
найти в «Российском медицинском журнале» № 2 за 2001 год, либо
на сайте www.infectology.ru в разделе «Компетентное мнение».
Следует отметить, что при наличии у пациента развернутой
картины, сходной с манифестной формой хронического токсоплаз-
моза, в первую очередь необходимо исключить те заболевания, те-
рапия которых не может быть отсрочена (онкология, туберкулез,
33
48
www.tick.ru
10. Ананьева Л.П., Скрипникова И.А., Барскова В.Г., Ушакова
коллагеноз). На следующем этапе следует выявить и, по возможно-
М.А. Иммунологический гуморальный ответ у больных
сти, радикально санировать имеющиеся очаги хронической инфек-
Лаймской болезнью.Тер. архив, 1995, № 67, 53-56.
ции (ЛОР-органы, желчевыводящие пути, мочеполовая сфера и т.д.)
11. Крючечников В.Н., Коренберг Э.И., Щербаков С.В. и др.
и провести лечение других клинически значимых инфекций (хлами-
Идентификация боррелий, изолированных в СССР от кле-
диоз), потому что лечение токсоплазмоза при сохранении «дейст-
щей Ixodes persulcatus Schlze. Журн.микробиол. 1988. 12:41-
вующих» очагов будет не эффективным.
44.
Интерпретация результатов серологических исследований име-
12. Алексеев А.Н. Роль симпатрии и аллопатрии переносчиков
ет ведущее значение в двух ситуациях. Во-первых, отрицательные
для функционирования очагов трансмиссивных заболева-
результаты исследования на IgM и IgG на коммерческих тест-
ний. Докл. Акад. Наук. 1993, т.329, №5, 670-673.
системах позволяют надежно исключить токсоплазмоз. Во-вторых,
13. Коренберг Э.И. Таксономия, фиогенетические связи и об-
наличие IgM (с подтверждающим тестом, полуколичественно) по-
ласти формообразования спирохет рода Borrelia, передаю-
зволяет установить диагноз острого токсоплазмоза, стадия которого
щихся иксодовыми клещами. Усп. Соврем. Биол. 1996, т.
уточняется при оценке динамики Ig G.
116, в.4, 389-404.
Для диагностики хронических форм приобретенного токсо-
14. Korenberg E.I. Ixoddid tick-borne borrelioses (ITTB’s), infec-
плазмоза дополнительно требуется выявление гиперчувствительно-
tions of the Lyme borreliosis group, in Russi: country report. In:
сти замедленного типа к токсоплазмам путем постановки внутри-
Report of WHO Workshop on Lyme Borreliosis Diagnosis and
кожной пробы с разведенным SAG1. Отрицательный результат про-
Surveillance. Warsaw, Sanitati, 1995, p.128-136.
бы свидетельствует об отсутствии гиперчувствительности, положи-
15. Лобзин Ю.В., Усков А.Н., Козлов С.С. Лайм-боррелиоз (ик-
тельный – о ее наличии и, соответственно, необходимости проведе-
содовые клещевые боррелиозы). С.- Петергбург, Фолиант,
ния специфической терапии.
2000.
Определенные особенности диагностических подходов сущест-
16. Postic D., Korenberg E., Gorelova N/ et al. Borrelia burgdorferi
вуют в отношении детей, беременных, пациентов с поражением ор-
sensu lato in Russia and neighbouring countries: high incidence
гана зрения, пациентов со СПИДом. Однако их анализ выходит за
of mixed isolates. Res. Bicrobiol. 1997, 148: 691-702.
рамки настоящего доклада.
17. Горелова Н.Б., Коренберг Э.И., Постик Д. и др. Первая изо-
Таким образом, диагностика приобретенного токсоплазмоза яв-
ляция Borrelia burgdorferi sensu stricto в России. Журню
ляется достаточно сложной и трудоемкой, требующей всесторонней
микробиол, 2001, №4, с.10-12.
оценки целого комплекса клинико-лабораторных данных.
18. Иванов И.Д., Беклемишев А.Б. Использование рекомбинант-
ных антигенов Borrelia burgdorferi sensu lato для диагности-
ки Лайм – боррелиоза в России. Интернет сайт НИИ биохи-
мии СО РАМН, Новосибирск,2000.
19. Barbour A.G. Isolation and Cultivation of Lyme Disease Spiro-
hetes. Yale J. Biol. Medicine, 1984, 57: 521-525.
20. Polack R.J., Telfold S.R. and Spielman A. Standardization of
medium for Culturing Lyme Disease Spirohetes. J. Clin.
Microbiol. 1993, 31: 1251-1255.
21. Postic D., Assous M., Grimont P.D.A. and Baranton G. Diversity
of Borrelia burgdorferi sensu lato evidenced by restriction frag-
ment length polymorphism of rrf(5S) – rrl(23S) intergenic spaser
amplicons. Int. J. Syst. Bacteriol. 1994, 44: 743-752.


47
34
www.tick.ru
гена является высокий процент ложноположительных реакций. Од- ВЫДЕЛЕНИЕ И ИЗУЧЕНИЕ НЕКОТОРЫХ СВОЙСТВ ИЗО-
нако если учесть, что эти тесты применяются для подтверждения
ЛЯТОВ BORRELIA BURGDORFERI SENSU LATO ИЗ КЛИНИ-
диагноза, основанного на клинических данных, а не для массовых
ЧЕСКИХ ОБРАЗЦОВ И ВЕКТОРОВ-ПЕРЕНОСЧИКОВ.
скрининговых исследований, то это не является принципиальным
недостатком. Планшеты для ELISA с антигенной подложкой
Штанников А.В1., Баранова Е.В1 ., Евсегнеев С.И1., Решетняк Т.В1.,
Borrelia burgdorferi sensu stricto Taldom №17 были сравнены с
Реполовская Т.В1., Прилипов А.Г4 .,Колосова Н.В1., Наумов Р.Л3., Би-
Вorrelia(Lyme)TEST производства фирмы ImmunoWELLR . По спе-
кетов С.Ф1, Ананьева Л.П2.
цифичности их характеристики одинаковы.
В заключении необходимо сказать, что, учитывая полиморфизм
Государственный Научный Центр Прикладной Микробиологии,
антигенов боррелий в зависимости от их географического ареала,
Оболенск1; Институт ревматологии РАМН, Москва2; Институт ме-
необходимо дальнейшее расширение коллекции штаммов возбуди-
дицинской паразитологии и тропической медицины им. Марцинов-
теля, а также проведение генетических работ по изучению природы
ского3, Москва; Институт вирусологии им. Ивановского, Москва4.
боррелиозных генов и их клонированию. Это позволит создавать
комбинации антигенов, обладающие наряду с высокой чувствитель-
ностью необходимой специфичностью.
При культивировании в среде BSK II 15 клинических био-
ЛИТЕРАТУРА.
птатов, а также 10 клещей удалось выделить 3 изолята
1. Аnonymous (1995) Lyme disease. United States, 1994. Morbid. Borrelia burgdorferi sensu lato(2 клинических и 1клещевой).
Mortal. Week Rep. 44, 459-462. Генотипирование этих изолятов было осуществлено мето-
2. Nocton. J.J. and Steere, A.C. (1995 ) Lyme disease. Adv. Intern. дом PCR-RFLP анализа. Оба клинических варианта оказа-
Med. 40, 69-115. лись B. garinii, а клещевой вариант – B.burgdorferi sensu
3. Centers for Disease Control: Lyme disease – United States, 1994. stricto. Штаммам была присвоена следующая аббревиатура:
MMWR Morb Mortal Wkly Rep. 1995; 44:459-462. Borrelia burgdorferi sensu stricto Taldom №17, B. garinii Siu и
B.garinii Col. При сравнении антигенного спектра выделен-
4. Jaenson TGT. The epidemiology of Lyme borreliosis. Parasitol
ных штаммов с лабораторными штаммами Borrelia
Today.1991; 7: 39-45.
burgdorferi sensu stricto B31 и 39/40 у штаммов Siu и Col на-
5. Коренберг Э.И. Боррелиозы. В: В.И. Покровский.(ред). Ру-
блюдалась мажорная дополнительная полоса в области 25
ководство по эпидемиологии инфекционных болезний. М.,
кДа, а у штамма №17 качественные и количественные раз-
Медицина, 1993,3, с.382-391. личия наблюдались в Western-блотте в области 18-25, 29-41
6. Коренберг Э.И. Иксодовые клещевые боррелиозы как группа и 57кДа. Штамм Borrelia burgdorferi sensu stricto №17 был
заболеваний человека и главные итоги её изучения в России. наработан в препаративных количествах и использовался
Журн. Инфекц.патол. 1996, 3(4):22-24. как корпускулярный антиген для НРИФ, а также для полу-
7. Коренберг Э.И., Горелова Н.Б., Постик Д. и др. Резервуар- чения клеточных лизатов при разработке иммунофермент-
ные хозяева и переносчики боррелий – возбудителей иксо- ной тест системы(ELISA).
довых клещевых боррелиозов в России. Журн. Микробиол.
Болезнь Лайма (клещевой боррелиоз) – глобально распростра-
1997, 6: 36-38.
нённый по всему северному полушарию зооноз. Главными этиоло-
8. А.Н. Алексеев. Антропогенный пресс, патоморфология пе-
гическими агентами, вызывающими заболевание, в настоящее время
реносчика, обилие возбудителя болезни Лайма. Докл. Акад.
считаются в Северной Америке - Borrelia burgdorferi sensu stricto, а
Наук. 1995, т.340, № 4, 563-565.
в Старом свете - Borrelia burgdorferi , Borrelia garinii и Borrelia
9. Ананьева Л.П., Барскова В.Г., Скрипникова И.А., Насонова
afzelii. К этому списку с некоторыми оговорками добавляют также
В.А. Лайм-артрит. Тер. Архив, 1993, №12, 82-87.
Borrelia bissettii. sp. nov и Borrelia valaisiana (1 – 4).

35
46
www.tick.ru
номичнее готовить среду в лабораторных условиях, а не использо-
Территория России является наиболее протяжённым районом
вать её фабричные аналоги.
Лайм-инфекции в мире, так как болезнь регистрируется от побере-
Высокий процент заражения посторонней микрофлорой клини-
жья Балтийского моря до Тихого океана(5,6). Основными перенос-
ческих биоптатов указывает на то, что их забор следует проводить в
чиками являются таёжный клещ Ixodes persulcatus и лесной клещ
специальных боксах. Добавление антибиотиков в среду не всегда
Ixodes ricinus(7). По предварительным данным института медицин-
благоприятно сказывается на первых этапах выделения боррелий.
ской паразитологии и тропической медицины им. Марциновского и
Типирование новых изолятов боррелий необходимо для систе-
Зоологического института РАН(8) обсеменённость клещей спирохе-
матики, составления эпидемиологических карт и клинического про-
тами Borrelia burgdorferi sensu lato в зависимости от района их сбо-
гноза течения заболевания. Наиболее удобна для этого ПЦР - диаг-
ра и сезона составляет в разные годы от 25 до 60%.
ностика. Метод достаточно производителен и, главное, не требует
В России фундаментальные исследования болезни Лайма до не-
выделения микроорганизмов. Для таксономии боррелий чаще всего
давнего времени практически не проводились. Это связано с тем,
используют PCR-RFLP анализ и PCR-RLB-анализ. Первый вариант
что наработка больших количеств биомассы боррелий сопряжена со
проще в методическом отношении, поэтому мы остановились на
значительными трудностями из-за чрезвычайной требовательности
нём. Правда, анализ картины распределения рестриктов требует
боррелий к условиям культивирования. Доступная информация о
наличия ДНК эталонных штаммов. В нашем распоряжении имелись
культивировании боррелий и выделении их антигенных детерми-
только штаммы Borrelia burgdorferi sensu stricto. Поэтому, при ти-
нант в отечественной литературе отсутствует. Эксмериментальные
пировании штаммов Siu и Col дополнительно использовались лите-
работы ограничиваются, в основном, наблюдениями в клинике, сбо-
ратурные и клинические данные, а также результаты определения
ром клещей в полевых условиях и систематическими исследова-
последовательности OspA гена (данные не приведены). Вероятно,
ниями. (9 - 17).
ПЦР-диагностику всегда целесообразно совмещать с другими мето-
Хотя имеются отдельные устные сообщения о разработке оте-
дами генотипирования, например, с сиквенсом какого- либо консер-
чественных препаратов (18), серодиагностика заболевания с помо-
вативного гена.
щью иммуноферментного метода в российских медицинских учре-
В настоящее время метод НРИФ является в России основным
ждениях проводится только на основе зарубежных тест-наборов.
при серодиагностике болезни Лайма. Корпускулярный антиген
Целью нашей работы было, во-первых, воспроизвести результа-
Borrelia burgdorferi Taldom №17 получил хорошие отзывы при ла-
ты по культивированию и генотипированию боррелий, полученные
бораторных испытаниях в различных регионах России. Однако глав-
зарубежными авторами. Во-вторых, оптимизировать условия куль-
ный упор был сделан на создании иммуноферментных тест-ситем,
тивирования, варьируя различные параметры внешней среды и ком-
как более надёжных и перспективных.
поненты среды BSK II. В-третьих, попытаться разработать тест-
Импортные иммуноферментные диагностикумы «Merdox»,
системы для серодиагностики на основе антигенов отечественных
«Immunitix» и др., используемые в России, дают положительную
изолятов боррелий.
реакцию не более, чем в 30% случаев клинически подтверждённого
Материалы и методы.
диагноза болезни Лайма. В качестве антигенных компонентов в них
Бактериальные штаммы. В работе использовались лабора-
используются наборы антигенов, присущих боррелиям тех стран,
торные штаммы Borrelia burgdorferi sensu stricto B31 и 39/40. Они
где они выявлены. Между тем уже доказано, что антигенные спек-
были получены от проф. Карша из Института гигиены и микробио-
тры спирохет даже близко расположенных географических зон мо-
логии Вюрцбургского университета и доктора Стира из Медицин-
гут существенно отличаться. По предварительным результатам, по-
ской школы Тафтского университета, соответственно, а также
лученные на основе российских изолятов образцы тест-систем,
штаммы Borrelia burgdorferi sensu stricto Taldom №17, B. garinii Siu
практически в два раза превосходят по чувствительности импорт-
и B. garinii Col, выделенные авторами статьи.
ные.
Условия культивирования. Отработку условий выделения и
Основной проблемой в серодиагностике Лайм - боррелиозов
наработки биомассы боррелий проводили в среде BSKII(19,20) и её
при использовании тестов на основе суммарного клеточного анти-
модификациях. Культивирование вели в пластиковых одноразовых
45
36
www.tick.ru
пробирках или в пробирках из нейтрального стекла с плотно закру-
чивающимися крышками, заполненными средой на 90%. Пробирки
Видно, что штамм Taldom №17 обладает самым большим набо-
инкубировали в термостате при 33?С в течение 12 недель. Рост бор-
ром иммунореактивных антигенов. В его препарате хорошо пред-
релий контролировали еженедельно с помощью темнопольного
ставлены все диагностически значимые полосы с молекулярной
микроскопа (Yenoval,х250)., а также по изменению окраски среды.
массой 93, 80, 66, 60, 58, 45, 41, 39,37, 34, 31, 28, 25, 21, 18 кДа.
Концентрация боррелий в эталонных и рабочих культурах опреде-
Штамм Borrelia burgdorferi sensu stricto №17 был наработан в
лялась как среднее число боррелий, полученное при просмотре 10
препаративных количествах и использовался, как корпускулярный
полей зрения, умноженное на 106.
антиген для НРИФ, а также в качестве антигенной подложки при
Выделение боррелий из клещей. 20 клещей были получены из
разработке иммуноферментной тест - системы(ELISA). Опытные
СЭС Серпуховского района Московской области. Сбор клещей в
образцы антигена для НРИФ были разосланы в 10 регионов России.
полевых условиях проводился в Tалдомском районе Московской
Из 7 получен ответ, что препарат не уступает по своим свойствам
области флагом в мае месяце 2000г. Клещи помещались в специаль-
гамалеевскому антигену Ip21. Иммуноферментный тест прошёл
ные пробирки и хранились при 4?С. Перед культивированием каж-
предварительную проверку в институте ревматологии и показал
дый клещ 10 минут инкубировался в 70% этаноле и затем трижды
70% чувствительность(IgG плюс IgM) с сывороткам от больных с
промывался по 60 секунд в стерильной дистиллированной воде. В
клинически подтверждённым диагнозом болезни Лайма. При анали-
дальнейшем клещи помещались в стерильную ступку с 50мкл PBS и
зе специфичности наблюдались перекрёстные реакции с сыворотка-
растирались пестиком до гомогенного состояния в течение 1-2 ми-
ми от больных сифилисом и лептоспирозом.
нут. Для предварительной оценки обсеменённости клещей борре-
Обсуждение. Организация мониторинга за возбудителем Лайм -
лиями 15 мкл образца наносили на предметное стекло и просматри-
боррелиоза на территории России является актуальной задачей (5-
вали не менее 100 полей зрения. Оставшуюся часть инокулировали
7,11,13,14). Однако создание представительной коллекции, изучение
в пробирку со средой BSK II. Чтобы предотвратить контаминацию
антигенного состава российских изолятов и конструирование имму-
посторонней микрофлорой I добавляли антибиотики в следующих
нохимических тест – систем подразумевает возможность выделения
концентрациях: рифампицин – 50 мкг/мл, амфотерицин В – 2,5
и культивирования боррелий. Между тем стоимость 1 литра им-
мкг/мл, фосфомицин – 20 мкг/мл, ципрофлоксацин – 0,5 мкг/мл.
портной среды равняется 150 долларам США, что ограничивает её
Пробирки, засеянные гомогенатом клещей, помещали на 33° С и ин-
применение при наработке биомассы в препаративных количествах.
кубировали в течение 12 недель.
Поэтому была проведена работа по приготовлению среды BSK II
Выделение боррелий из кожных клинических биоптатов.
самостоятельно(at home). Выяснено, что при использовании им-
Операционное поле тщательно дезинфицировалось спиртовой на-
портных реактивов высокого качества полученная среда превосхо-
стойкой йода, и из пограничной области мигрирующей эритемы
дит фирменный аналог complete media BSK H (Sigma). На свойства
специальным панчем брался кожный лоскут площадью 6 мм2 так,
среды заметно влияет способ её приготовления. Эксперименты по
чтобы захватить ткань по обе стороны границы эритемы. Первые 7
замене наиболее дорогостоящих компонентов отечественными ана-
дней биоптаты инкубировались в 1мл центрифужных пробирках в
логами показали, что их можно использовать для наработки боль-
среде BSK II без кроличьей сыворотки, затем супернатант и биоптат
ших количеств биомассы боррелий, когда посевная доза велика и не
порознь переносили в пробирки с 10 мл полной средой BSK II. Про-
требуется высокая чувствительность среды. Так как российский
бирки инкубировались при 33· С в течение трёх месяцев.
бычий сывороточный альбумин на порядок дешевле импортного, то
Генотипирование штаммов боррелий методом RFLP-PCR
это является существенным моментом. Для выделения боррелий из
анализа. Nested PCR осуществляли с помощью двух пар праймеров
различных источников пока приходится пользоваться BSK II из им-
к 3’ концу первого 5S рРНК гена(rrfA) и 5’концу второго 23S рРНК
портных реактивов. Низкое качество фирменной среды, вероятно,
гена(rrlB): 23SN1 (5'-ACCATAGACTCTTATTACTTTGAC) и 23SC1
связано с тем, что при доставке её в Россию не всегда соблюдаются
(5' –TAAGCTQACTAATACTAATTACCC) - для первого этапа ам-
необходимые условия хранения. Возможно также колебание
плификации; 23SN2 (5' –ACCATAGACTCTTATTACTTTGACCA) и
свойств от партии к партии. Таким образом, целесообразнее и эко-
37
44
www.tick.ru
литературе для штаммов B. garinii. На основании этой информации,
5SCB (S'-GAGAGTAGGTTATTGCCAGGG) –для второго
а также по результатам сиквенса ДНК OspA гена (данные не приве-
(21,22).Реакционная смесь для первого этапа состояла из: 2,5мкл 10х
дены), штамм Taldom №17 был типирован, как Borrelia burgdorferi
реакционного буфера; 2,5 мкл 2мМ dNTP, 0,25 мкл Taq-
sensu stricto, а штаммы Siu и Col, как B. garinii.
полимеразы(5ед/мл); по 0 .5 мкл праймеров(5pmol); 5 мкл образца,
Электрофоретическая и иммунохимическая характеристика
вода до 25 мкл. Смесь перемешивали пипетированием, наносили
антигенных препаратов боррелий. Электрофоретический анализ
сверху 6 капель вазелинового масла и помещали в микроцик-
лер(Mini cyclerTM MJ Research Inc, USA). Амплификацию проводили лизатов боррелий показал наличие широкого спектра белков, боль-
шинство из которых были общими у всех штаммов. Однако наблю-
по программе: 94?С – 1 мин; затем 25 циклов: 94?с-30 сек, 52?С-30
дались и индивидуальные особенности. Так, препараты клиниче-
сек, 72?С- 1 мин. Для проведения второго этапа готовили новую ре-
ских изолятов боррелий “Siu” и “Col” отличались от штамма клеще-
акционную смесь: 0,5 мкл 10х реакционного буфера; 0,25 мкл Taq-
вого изолята “Taldom” и штамма B. burgdorferi sensu stricto 39/40
полимеразы(5ед/мл); по 0 .5 мкл праймеров(5pmol); 1,5 мкл 20мМ
присутствием мажорной белковой зоны 25 кДа.
dNTP, вода до 5мкл. Смесь подслаивали под масло в пробирку, и
Дополнительные отличия удалось выявить в Western - блоте,
амплификацию проводили по программе: 94?С – 1 мин; 40 циклов:
используя панель сывороток больных с клинически подтвержден-
94?С - 30 сек, 55?С – 30 сек, 72?- 1 мин. К 12 мкл амплификата до-
ным диагнозом болезни Лайма (Рис.2).
бавляли 2мкл 50 мМ MgCl2, 1 мкл Tru 1I(Mse I). Смесь инкубирова-
ли 1 час при 65?С и наносили на акриламидный 16%гель с 6М моче-
виной, предварительно разбавив суспензию равным объёмом фор-
мамида. Распределение рестриктов анализировали после электро-
фореза в постоянном электрическом поле с Е=10в/см. В качестве
эталона использовалась ДНК штамма Borrelia burgdorferi sensu
stricto B31.
Иммунохимический анализ. Антигенный препарат боррелий
получали ультразвуковой дезинтеграцией 5мл суспензии боррелий с
концентрацией 109кл\мл на аппарате VirSonic 100. Режим обработки
3 раза по 15сек с 45сек перерывом. Полученный образец охлаждали
на льду в течение 1 часа и затем центрифугировали при 5 000g
30мин. Для работы использовали супернатант. Концентрацию белка
в образцах определяли по методу Лоури(23).
Для изучения белкового состава препараты боррелий анализи-
ровали в вертикальном SDS-электрофорезе по Лэммли (24). Элек-
трофоретическую сепарацию белков боррелий проводили в 12% по-
лиакриламидном геле.
Иммуногенную активность имеющихся препаратов оценивали в
(ELISA) и методом Western-blot(25). В качестве специфических им-
муноглобулинов использовали сыворотки больных болезнью Лайма,
предоставленные НИИ Ревматологии. Перенос белков из геля на
нитроцеллюлозную бумагу(Nitrocellulose membrane,
Рисунок 2. Иммуноблот антигенных препаратов боррелий с пулом
Sigma)осуществлялся с помощью полусухого электроблоттера(26).
сывороток больных:
Участки неспецифического взаимодействия мембраны блокировали
1- природный изолят штамм “Taldom”; 2- штамм биоптата
в течение 30 мин. раствором 5 % обезжиренного молока с 0.05 %
“Siu”; 3- штамм биоптата “Col”; 4- штамм 39/40 (USA).
Твин 20 в 0.01 М фосфатно-солевой буфере, рН - 7.4 . Далее мем-
43
38
www.tick.ru
брану в течение часа инкубировали с сыворотками в разведении 1:
боррелий обнаружено не было. В гомогенатах 10 клещей, собран-
200. После отмывки мембрана обрабатывалась в течение 30 мин ра-
ных в Талдомском районе, в тёмном поле наблюдались спирохеты в
бочим разведением вторых антител против человеческих IgG и IgM,
количестве одна-две в 100 полях зрения. В процессе трёхнедельного
конъюгированных с пероксидазой хрена. Визуализацию специфиче-
культивирования удалось выделить 1 вариант боррелий, получив-
ского иммунохимического взаимодействия на мембране проводили
ший название Taldom №17.После предварительной расчистки он
субстратной смесью: 0.05 % диаминобензидина; 0.015 % Н2 О2;
был отклонирован последовательным разведением до единичных
0.01 М ФСБ рН - 7.4.
клеток.
Сыворотки. 209 образцов сывороток были получены из Инсти-
Выделение боррелий из биоптатов. Из института Ревматологии
тута ревматологии (Москва). Из них 115 от больных с клинически
АМН Российской Федерации было получено 15 кожных биоптатов
подтверждённым диагнозом болезни Лайма. Самые высокотитраж-
от больных с клинически подтверждённым диагнозом болезни Лай-
ные сыворотки были объединены в пул, который использовался, как
ма. Несмотря на предпринятые асептические мероприятия 7 из них
положительный контроль. Референс сыворотки на сифилис и леп-
заросли посторонней микрофлорой. Из оставшихся образцов уда-
тоспироз были получены из ЦКВИ (Москва).
лось выделить 2 варианта, обозначенные по имени пациентов Siu и
Результаты.
Kol. Вариант Siu выделился после 6 недель культивирования, а ва-
Оптимизация режима культивирования боррелий и моди-
риант Kol - после 12 недель. Оба варианта были отклонированы по-
фикация питательной среды. Данных об особенностях метабо-
следовательным разведением до единичных клеток.
лизма боррелий очень мало. Тем не менее, многолетние эмпириче-
Идентификация выделенных вариантов. В результате Nested-
ские попытки привели к созданию так называемой среды BSK II,
PCR из всех изолятов были получены амплификаты в 225 пар осно-
пригодной для культивирования боррелий in vitro и выделения их
ваний, соответствующие фрагменту спейсерного участка между ри-
из различных источников. Рецептура среды с небольшими модифи-
босомальными генами rrfA и rrlB, которые в дальнейшем обрабаты-
кациями используется практически всеми исследователями, зани-
вались ферментом Mse I (рис.1).
мающимися этой проблемой. Однако в России эта среда не произ-
водится. Это связано с тем, что для её состава нужны компоненты
очень высокого качества.
На первом этапе работ основное внимание было уделено само-
стоятельному приготовлению среды BSK II(at home), так как из-
вестно, что её качество сильно зависит не только от свойств компо-
нентов, но и от порядка их смешивания. Для приготовления среды
BSK II использовались реактивы только фирмы "Sigma", "Gibco" и
"Difco". Контролем в экспериментах служила фирменная среда для
боррелий – complete media BSK H(Sigma). Ниже приводится состав
среды BSK-II и рекомендуемый способ её приготовления.
Готовую среду расфасовать в герметически завинчивающиеся
культуральные ёмкости (пробирки, флаконы) так, чтобы заполнить
их на 9/10 объема.
Среда сохраняет свои ростовые свойства в течение 2 месяцев
Рисунок 1. Распределение Mse I –рестриктов ДНК из штаммов при хранении при +4oС и 1 год при - 20oС.
Borrelia burgdorferi sensu lato.
Видно, что распределение рестриктов у штамма В31 практиче-
ски совпадает с таковым у штамма Taldom №17. Рестрикционная
картина у вариантов Siu и Col схожа с данными, преставленными в

39
42
www.tick.ru
32, 37, 39 и 40 градусов в термостате, как с повышенной концентра-
Желатин 5,7%
[A]
В колбу на 2000 мл налить 300мл прогретой до 50?С деио- цией СО2, так и без него в течение 12 недель. Визуальный контроль
проводился каждые 2 дня.
низованной воды (?= 12- 15 Мом). Добавить 17 г желатина
При температуре 32oС и 37oС среда BSK II( at home) обеспечи-
и перемешивать до полного растворения. Автоклавировать
вает рост культур из инокулюма 20-100 спирохет и итоговый выход
при 1 атм. 30 минут.
боррелий 1-5·108 на миллилитр. Время генерации составляет при-
В 300 мл прогретой до 50o С деионизованной воды раство-
[B]
мерно 7-9 часов. Визуально увеличение титра спирохет можно было
рить:
наблюдать уже через 4 –5 дней, а максимальной плотности культура
Neopepton 5г
достигает через 4-6 недель. Рост спирохет придонный. Осадок со-
Trypton 1г
стоит из довольно крупных рыхлых агрегатов, которые быстро осе-
Yeastolate 1г
дают при взбалтывании суспензии. При температуре 39oС рост рез-
Охладить до комнатной температуры и добавить в колбу
ко замедляется, появляются длинные нитеобразные формы, а при
[С].
40oС вообще прекращается.
[C] В колбу на 2000 мл добавить:
Присутствие углекислого газа не оказывало существенного
Деионизированной воды 500 мл
влияния на интенсивность размножения боррелий. Таким образом,
10х CMRL Medium – 1066 100 мл
использование анаэростатов или иных специальных приспособле-
HEPES 6г
ний для культивирования боррелий необязательно.
Лимоннокислый натрий 0,7 г
Фирменная среда BSK H по сравнению с приготовленной само-
D-глюкоза 5г
стоятельно средой BSK II обеспечивала в тех же условиях выход
Пируват натрия 0,8 г
лишь 107 боррелий на миллилитр.
N-ацетил-D-глюкоза мин 0,4 г
Из 8 проверенных кроличьих сывороток только 3 стимулирова-
MgCl2·H2O 0,3 г
ли рост боррелий, на уровне протестированной фирменной сыво-
Бикарбонат натрия 2,2 г
ротки (Sigma). Они были наработаны в больших количествах и по-
L-глутамин 0,146 г
мещены на хранение при -70?С для использования в дальнейших
[D] 143 мл 35% бычьего сывороточного альбумина прогреть до
экспериментах.
37oС и добавить в колбу [С].
Инактивация системы комплемента прогревом сыворотки в те-
100 мл нормальной кроличьей сыворотки, профильтровать
[E]
чение 20 мин при 56?С обязательна, если среда засевается единич-
предварительно через Whatman # 1, а затем через стериль-
ными клетками. Если же инокулюм превышает 103 кл/мл, то при-
ный фильтр с диаметром пор 0,45 мкм.
рост биомассы наблюдается более интенсивно при использовании
Довести pH среды в колбе [C], содержащей компоненты
[F]
интактных кроличьих сывороток. Присутствие в сыворотке не-
[B], [C], [D], до 7,5 5М раствором NaOH.
больших количеств гемоглобина не влияет на рост боррелий.
[G] Полученную смесь профильтровать сначала через стериль-
Замена самых дорогостоящих компонентов среды BSK II: V
ный фильтр с диаметром пор 0,45 мкм, а затем – 0,22 мкм.
фракции бычьего сывороточного альбумина (Sigma) на отечествен-
[H] В колбу [C] стерильно добавить прогретый до 37?С жела-
ный белок, а среды CMRL 1066(Gibco) на среду №199 даёт удовле-
тин [A] и кроличью сыворотку [E].
творительные результаты, если посевная доза превышает 1000 кле-
Отработка условий культивирования проводилась на штамме
ток на мл. Выход биомассы составляет 6-8· 107 кл/мл.
Borrelia burgdorferi sensu stricto B31. Этот штамм является эталон-
Подобранные условия культивирования оказались оптималь-
ным лабораторным штаммом, что позволяет при отработке методи-
ными для всех используемых в работе штаммов боррелий.
ки сопоставлять результаты.
Выделение боррелий из клещей. При микроскопическом ана-
Различные разведения культур (105, 104, 103, 102 кл/мл) засева-
лизе содержимого кишечника 20 клещей, снятых с людей, обратив-
лись по 1-2 капли в пробирки со средой BSK II. На каждую точку
шихся в разное время в Серпуховскую СЭС, ни в одном из случаев
бралось по 3 пробирки. Пробирки инкубировались при температуре
41
40

<<

стр. 2
(всего 2)

СОДЕРЖАНИЕ